Schlagwort-Archive: 300 Dollar

WWDC: Apple startet als Tiger und landet als Bettvorleger

Wie auch andere Entwicklergruppen übertrug die alternative Entwicklerkonferenz AltConf schon seit Jahren Apples Keynote von der heute beginnenden Apple-Entwicklerkonferenz WWDC live, ohne deshalb jemals Ärger zu bekommen. In diesem Jahr aber wollte der iPhone-Hersteller erfahren haben, dass die Veranstalter angeblich Tickets zum … Weiterlesen

Veröffentlicht unter Internet, Kommentar, News, Programmierung, Soziales, Tipps und Tricks, Wirtschaft | Verschlagwortet mit , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , | Hinterlasse einen Kommentar

Yahoo verkauft jetzt Gentests: Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (…) gekauft.

Der amerikanische Internetkonzern Yahoo beackert nach einem Golem-Bericht ein neues Geschäftsfeld: In Kooperation mit einem Partner verkauft der Konzern ab Dezember Gentests, mit denen man feststellen kann, ob man für bestimmte Krankheiten genetisch disponiert ist. Das Angebot nennt sich Gene … Weiterlesen

Veröffentlicht unter Internet, Soziales, Wirtschaft | Verschlagwortet mit , , , , , , , , | Hinterlasse einen Kommentar