Schlagwort-Archive: Risiken

Bundesrechnungshof kritisiert Modernisierung der Staats-IT

Scharfe Kritik am teuersten IT-Projekt der Bundesregierung, der Modernisierung und Vereinheitlichung der IT-Landschaft in über 200 Bundesbehörden und den Ministerien, äußert der Bundesrechnungshof. Die Kritik des Bundesrechnungshofes Wenn die aktuellen Probleme und Mängel nicht abgestellt werden, „droht das Projekt zu … Weiterlesen

Veröffentlicht unter Allgemeines, Kommentar, News, Politik, Recht, Soziales, Wirtschaft | Verschlagwortet mit , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , | Hinterlasse einen Kommentar

Foto: Gelber Sonnenhut

Diese Pflanze passt zum Sommer wie die Faust aufs Auge – nicht nur dem Namen nach. Der Sonnenhut (Echinacea) hat den Schwerpunkt seiner Blüte jetzt im Hochsommer. Als Heilmittel eher ein Versager… Echinacea ist zwar als alte Heilpflanze bekannt, die angeblich schon … Weiterlesen

Veröffentlicht unter Allgemeines, Fotografie, Lokales, Mobilgeräte, Soziales, Tipps und Tricks | Verschlagwortet mit , , , , , , , , , , , , , , , , , , , , , , , , , , , , | Hinterlasse einen Kommentar

Wikileaks enthüllt die CIA-Abhörmethoden in Deutschland

Von Fake-Virenscannern und einem Fake-Off-Modus für Smart-Fernseher berichtet Wikileaks im Rahmen der Veröffentlichung von Dokumenten des amerikanischen Geheimdienstes CIA, deren Echtheit von Experten auch nicht angezweifelt wird. Kein Grund, seinen Fernseher aus der Steckdose zu ziehen, wenn er nicht gerade von Samsung stammt. … Weiterlesen

Veröffentlicht unter Internet, Kommentar, News, Politik, Programmierung, Recht, Sicherheit, Soziales | Verschlagwortet mit , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , | Hinterlasse einen Kommentar

50.000 Product Keys von Microsoft Deutschland gesperrt

Microsoft hat sich jetzt mit der Sperrung von 50.000 Product Keys gegen eine neue Art von Softwarepiraterie gewehrt. Diese 25-stelligen Zeichenketten für die Aktivierung von MS Windows oder MS Office wurden den Kunden als angebliche Lizenzen verkauft. Dabei hat es … Weiterlesen

Veröffentlicht unter Internet, News, Recht, Sicherheit | Verschlagwortet mit , , , , , , , , , , , , , , , , , | Hinterlasse einen Kommentar

Der Unsinn mit den Paketdrohnen

DHL, Amazon und jetzt auch Google mit seinem Projekt Wing (Flügel) – in diesem Jahr fühlt sich wirklich jeder, der nur im Entferntesten mit Paketbeförderung zu tun hat, aufgerufen, eine Paket-Zustell-Drohne für die letzte Meile vorzustellen. Das ist natürlich alles kompletter … Weiterlesen

Veröffentlicht unter Allgemeines, Internet, Kommentar, Lokales, News, Politik, Recht, Sicherheit, Soziales, Wirtschaft | Verschlagwortet mit , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , | Hinterlasse einen Kommentar

Tesla-Gründer will Weltproduktion von Akkus verdoppeln

Elon Musk hat mal wieder eine Vision. Der Gründer des Elektroautoherstellers Tesla will nach einem Bericht der Technology Revieweine eine schon gigantisch zu nennende neue Herstellungsstraße aufbauen. Diese neue Fabrik soll innerhalb von drei Jahren entstehen und soll die Weltproduktion von … Weiterlesen

Veröffentlicht unter Allgemeines, Kommentar, News, Wirtschaft | Verschlagwortet mit , , , , , , , , , , , | Hinterlasse einen Kommentar

Facebooks WhatsApp-Übernahme wirft dunkle Schatten

Der Hamburger Datenschützer Johannes Caspar befürchtet nach der milliardenschweren WhatsApp-Übernahme durch Facebook neue Risiken für die Nutzer. Weil der immens hohe Preis von umgerechnet 14 Milliarden Euro wieder hereinkommen muss „kann man davon ausgehen, dass eine Kapitalisierung über die personenbezogenen … Weiterlesen

Veröffentlicht unter Internet, News, Sicherheit, Soziales, Wirtschaft | Verschlagwortet mit , , , , , , , , , , , , , , | Hinterlasse einen Kommentar

CEBIT: Web 2.0-Anwendungen testen mit Webmate

Wer denkt, dass es bei dieser Überschrift um ein Werkzeug für Programmierer oder Web-Entwickler geht, liegt voll daneben. Das an der Universität des Saarlandes entwickelte Programm soll komplex strukturierte Internetseiten automatisch daraufhin untersuchen, woher die einzelnen Inhalte wirklich kommen. Durch … Weiterlesen

Veröffentlicht unter Internet, Programmierung, Sicherheit, Soziales | Verschlagwortet mit , , , , , , , , | 2 Kommentare

Yahoo verkauft jetzt Gentests: Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (…) gekauft.

Der amerikanische Internetkonzern Yahoo beackert nach einem Golem-Bericht ein neues Geschäftsfeld: In Kooperation mit einem Partner verkauft der Konzern ab Dezember Gentests, mit denen man feststellen kann, ob man für bestimmte Krankheiten genetisch disponiert ist. Das Angebot nennt sich Gene … Weiterlesen

Veröffentlicht unter Internet, Soziales, Wirtschaft | Verschlagwortet mit , , , , , , , , | Hinterlasse einen Kommentar