Yahoo verkauft jetzt Gentests: Kunden mit Sequenz GATAAATCTGGTCTTTATTCC haben auch (…) gekauft.

Der amerikanische Internetkonzern Yahoo beackert nach einem Golem-Bericht ein neues Geschäftsfeld: In Kooperation mit einem Partner verkauft der Konzern ab Dezember Gentests, mit denen man feststellen kann, ob man für bestimmte Krankheiten genetisch disponiert ist.

Das Angebot nennt sich Gene Life 2012, und Käufer senden eine Speichelprobe an den Tokioter Partner Genesis Healthcare, wo dann 68 Gentechnische Dispositionen zu Krankheiten wie Schlaganfall, Diabetes oder Herzkrankheiten überprüft werden.

Die Tests sollen ca. 300 Dollar kosten, die Auswertung braucht ca. zwei Montae und es gibt Hinweise zur Lebensführung, um ggfs. festgestellte Risiken zu minimieren.

Ob das wohl auf die teuerste Managerin der Welt, Marissa Mayer mit 19.230 $ Stundenlohn zurückzuführen ist? Die extra von Google geholte Spitzenfrau muss sich ja was einfallen lassen, um die kränkelnde Suchmaschine Yahoo wieder auf Vordermann zu bringen.

Über Klaus

Ich beschäftige mich schon seit 40 Jahren mit dem Internet. Meine Schwerpunkte sind Seitenerstellung, Programmierung, Analysen, Recherchen und Texte (auch Übersetzungen aus dem Englischen oder Niederländischen), Fotografie und ganz besonders die sozialen Aspekte der "Brave New World" oder in Merkel-Neusprech des "Neulands".
Dieser Beitrag wurde unter Internet, Soziales, Wirtschaft abgelegt und mit , , , , , , , , verschlagwortet. Setze ein Lesezeichen auf den Permalink.

Schreibe einen Kommentar

Deine E-Mail-Adresse wird nicht veröffentlicht.

Diese Website verwendet Akismet, um Spam zu reduzieren. Erfahre mehr darüber, wie deine Kommentardaten verarbeitet werden.